Sequence ID | >WENV183198059 |
Genome ID | OLPV01000457 |
Search identical group | |
Phylum/Class | [OLPV] human gut metagenome; faeces |
Species | |
Start position on genome | 24923 |
End posion on genome | 24998 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cccagccaat |
tRNA gene sequence |
GATCCACTAGCTCAGTTGGTAGAGCACCTGACTTTTAATCAGGGTGTCCCGAGTTCGAGT |
Downstream region at tRNA end position |
cgaattttag |
Secondary structure (Cloverleaf model) | >WENV183198059 Lys TTT t ACCA cgaattttag G - C A - T T - A C - G C - G A - T C - G T G T G G C T C A T G A A | | | | | G T C T C G C C G A G C G | | | | T T G G A G C T A A GTGTC C - G C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |