Sequence ID | >WENV183203901 |
Genome ID | OLPY01005331 |
Search identical group | |
Phylum/Class | [OLPY] human gut metagenome; faeces |
Species | |
Start position on genome | 4873 |
End posion on genome | 4946 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
aacagaatat |
tRNA gene sequence |
TGGGGATTTGCATAGTGGTAGTGCGGTAGACTCTGACTCTACTTGTGGGAGTTCGATTCT |
Downstream region at tRNA end position |
ggaagccatc |
Secondary structure (Cloverleaf model) | >WENV183203901 Gln CTG t ACCA ggaagccatc T - A G - C G - C G - C G - C A - T T - A T T T C T C T C A G A T | + | | | G T T A C G G G G A G C G + | | | T T G G T G C T A G TTGT G - C T - A A - T G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |