Sequence ID | >WENV183214311 |
Genome ID | OLQE01005667 |
Search identical group | |
Phylum/Class | [OLQE] human gut metagenome; faeces |
Species | |
Start position on genome | 2914 |
End posion on genome | 2832 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cgggatgcac |
tRNA gene sequence |
GCGCGAGTGGCGTAATGGTAGCCGCGCAGGATTTAGGTTCCTGTGTCTTCGGACGTGTGG |
Downstream region at tRNA end position |
gttccacaat |
Secondary structure (Cloverleaf model) | >WENV183214311 Leu TAG c ACCc gttccacaat G - C C - G G - C C - G G - C A - T G - C T G T T A C C C A T A A G + | | | | G G T G C G G T G G G C G | | | T T T C C G C A G G TGTCTTCGGACGT C - G A - T G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |