| Sequence ID | >WENV183215202 |
| Genome ID | OLQG01000358 |
| Phylum/Class | [OLQG] human gut metagenome; faeces |
| Species | |
| Start position on genome | 29682 |
| End posion on genome | 29609 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
actgatattt |
| tRNA gene sequence |
GCCCAGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCGGCGGTTCGATT |
| Downstream region at tRNA end position |
tttttacaac |
| Secondary structure (Cloverleaf model) | >WENV183215202 Phe GAA
t ACtc tttttacaac
G - C
C - G
C - G
C - G
A - T
G - C
A - T T T
T C T G C C A
T G A A | + | | | G
C C T C G G G C G G C
G | | | | T T
G G A G C
T A A GTGTC
G - C
A - T
G - C
G - C
A - T
C A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |