Sequence ID | >WENV183228048 |
Genome ID | OLQQ01016920 |
Search identical group | |
Phylum/Class | [OLQQ] human gut metagenome; faeces |
Species | |
Start position on genome | 81 |
End posion on genome | 7 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
cccgttacat |
tRNA gene sequence |
AGCCCTATAGTGTAATCGGTAACACAGCGGATTCTGGTTCCGTATTTTGGGGTTCGAGTC |
Downstream region at tRNA end position |
cttctannnn |
Secondary structure (Cloverleaf model) | >WENV183228048 Gln CTG t ACCA cttctannnn A - T G - C C - G C - G C - G T - A A - T T G T A C T C C A T A A A | | + | | G C T G T G T G G G G C G | | | | T T G A C A C T A A ATTT G + T C - G G - C G - C A - T T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |