Sequence ID | >WENV183231391 |
Genome ID | OLQU01000039 |
Search identical group | |
Phylum/Class | [OLQU] human gut metagenome; faeces |
Species | |
Start position on genome | 98260 |
End posion on genome | 98178 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ttttgtataa |
tRNA gene sequence |
GCGGGGGTGCCCGAGAGGCCAAAGGGGACAGGCTTAGGACCTGTTGACGCAGGTCTACCA |
Downstream region at tRNA end position |
taacaatttt |
Secondary structure (Cloverleaf model) | >WENV183231391 Leu TAG a Attc taacaatttt G - C C - G G - C G - C G - C G + T G - C T A T G T C C C A A G A G | | | | | A G G C C C C A G G G C G | | | T T C A G G G C A A G TGACGCAGGTCTAC A - T C - G A - T G - C G - C C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |