Sequence ID | >WENV183232859 |
Genome ID | OLQV01000059 |
Search identical group | |
Phylum/Class | [OLQV] human gut metagenome; faeces |
Species | |
Start position on genome | 48202 |
End posion on genome | 48276 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gaatgcaaac |
tRNA gene sequence |
TCCCCTGTAGCTCAGCGGTAGAGCGGGTGACTGTTAATCACTAGGTCGTTGGTTCGAGCC |
Downstream region at tRNA end position |
ctaattttct |
Secondary structure (Cloverleaf model) | >WENV183232859 Asn GTT c GCCA ctaattttct T - A C - G C - G C - G C - G T + G G - C C G T C A A C C A G A A | | | | | G C C T C G G T T G G C G | | | | T T G G A G C T A G AGGTC G + T G - C T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |