Sequence ID | >WENV183246504 |
Genome ID | OLRF01000183 |
Search identical group | |
Phylum/Class | [OLRF] human gut metagenome; faeces |
Species | |
Start position on genome | 81772 |
End posion on genome | 81845 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
aacgatatat |
tRNA gene sequence |
CGCGGGATGGAGCAGTTGGCAGCTCGTCGGGCTCATAACCCGAAGGTCGGAGGTTCGAGT |
Downstream region at tRNA end position |
aagtggacaa |
Secondary structure (Cloverleaf model) | >WENV183246504 fMet CAT t ACta aagtggacaa C T G - C C - G G - C G - C G - C A - T T G T C C T C C A T G A G | | | | | G T C G A G G G A G G C G | | | | T T G G C T C C A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |