Sequence ID | >WENV183251742 |
Genome ID | OLRI01000074 |
Search identical group | |
Phylum/Class | [OLRI] human gut metagenome; faeces |
Species | |
Start position on genome | 77186 |
End posion on genome | 77113 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ttgtatataa |
tRNA gene sequence |
GGGCCCGTAGCCTAGCTGGATAGGGCGTCGGACTTCTAATCCGAAGACCCCGGGTTCAAA |
Downstream region at tRNA end position |
ttcttataaa |
Secondary structure (Cloverleaf model) | >WENV183251742 Arg TCT a Gtat ttcttataaa G - C G - C G + T C - G C - G C - G G - C T A T G G C C C A C G A A | | | | | A T T C C G C C G G G C G + | | | T T G G G G C A T A G AGACC T - A C - G G - C G - C A - T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |