Sequence ID | >WENV183258570 |
Genome ID | OLRN01011285 |
Search identical group | |
Phylum/Class | [OLRN] human gut metagenome; faeces |
Species | |
Start position on genome | 1650 |
End posion on genome | 1725 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
acgtctcaac |
tRNA gene sequence |
GGGTCGTTAACTCAGTAGGTAGAGTATCTGCCTTTTAAGCAGAGAGTCGCAGGTTCGAAC |
Downstream region at tRNA end position |
tgacagataa |
Secondary structure (Cloverleaf model) | >WENV183258570 Lys TTT c ACCA tgacagataa G - C G - C G - C T - A C - G G - C T - A C A T C G C C C A T G A A | | | | G A C T C A G C A G G C G | | | | T T G G A G T T A A GAGTC T - A C - G T - A G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |