Sequence ID | >WENV183270353 |
Genome ID | OLRV01006531 |
Search identical group | |
Phylum/Class | [OLRV] human gut metagenome; faeces |
Species | |
Start position on genome | 5490 |
End posion on genome | 5400 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aacgacacct |
tRNA gene sequence |
GTCCGGGTGGCGGAATGGTAGACGCGCAAGCTTGAGGTGCTTGTGCCTATTTTATACAGG |
Downstream region at tRNA end position |
gcgaagaccc |
Secondary structure (Cloverleaf model) | >WENV183270353 Leu GAG t ACCA gcgaagaccc G - C T - A C - G C - G G - C G - C G - C T G T T A C C C A T A A G + | | | | A G G G C G G T G G G C G | | | T T T A C G C A G G TGCCTATTTTATACAGGCGT C - G A - T A - T G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |