Sequence ID | >WENV183274007 |
Genome ID | OLRY01000082 |
Search identical group | |
Phylum/Class | [OLRY] human gut metagenome; faeces |
Species | |
Start position on genome | 47577 |
End posion on genome | 47497 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
agaaaagttg |
tRNA gene sequence |
GCCTCCGTGGCGAAATGGTATACGCAGTCGACTTAAAATCGATCGCTTCGGCTTGTGGGT |
Downstream region at tRNA end position |
tgaaatcggc |
Secondary structure (Cloverleaf model) | >WENV183274007 Leu TAA g ACCt tgaaatcggc G - C C - G C - G T - A C - G C - G G - C T G T C A C C C A T A A G | | | | | G G A G C G G T G G G C G | | | T T T A C G C A T A CGCTTCGGCTT G + T T - A C - G G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |