Sequence ID | >WENV183281667 |
Genome ID | OLSC01000125 |
Search identical group | |
Phylum/Class | [OLSC] human gut metagenome; faeces |
Species | |
Start position on genome | 100875 |
End posion on genome | 100800 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
tattatttaT |
tRNA gene sequence |
GGCCTAGTGGCTCAGTTGGTTAGAGCGCCGCCCTGTCACGGCGGAGGTCACGGGTTCGAG |
Downstream region at tRNA end position |
cagtaattgt |
Secondary structure (Cloverleaf model) | >WENV183281667 Asp GTC T GTtt cagtaattgt G - C G + T C - G C - G T + G A - T G - C T G T T G C C C A T G A G | | | | | G T C T C G A C G G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |