Sequence ID | >C08000436 |
Genome ID | CP001132 |
Search identical group | |
Phylum/Class | Acidithiobacillia |
Species | Acidithiobacillus ferrooxidans ATCC 53993 [CP001132] |
Start position on genome | 696432 |
End posion on genome | 696360 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
atgacccgca |
tRNA gene sequence |
GCCTCGGTAGCTCAGTGGATAGAGCAACCGCCTCCTAAGCGGTAGGTCGCGCGTTCGATT |
Downstream region at tRNA end position |
tataaaacag |
Secondary structure (Cloverleaf model) | >C08000436 Arg CCT a Acca tataaaacag G - C C - G C - G T + G C - G G - C G + T T T T C G C G C A T G A A | | | | | G G C T C G G C G C G C G | | | | T T A G A G C T A A AGGTC A - T C - G C - G G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |