Sequence ID | >WENV183345013 |
Genome ID | OLWQ01029507 |
Search identical group | |
Phylum/Class | [OLWQ] human gut metagenome; feces |
Species | |
Start position on genome | 25 |
End posion on genome | 98 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cgcatatgtt |
tRNA gene sequence |
TGTCCTATGGTGTAATGGTAGCACAACAGTTTTTGGTTCTGTTTGTCTAAGTTCGAATCT |
Downstream region at tRNA end position |
aaaggaagct |
Secondary structure (Cloverleaf model) | >WENV183345013 Gln TTG t ACCA aaaggaagct T - A G - C T - A C - G C - G T - A A - T T A T G G T T C A A A G | + | | | G T T G T G C T A A G C G + | | | T T G G C A C T A A TTGT A - T C - G A - T G - C T T T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |