Sequence ID | >WENV183345193 |
Genome ID | OLWR01000084 |
Search identical group | |
Phylum/Class | [OLWR] human gut metagenome; feces |
Species | |
Start position on genome | 33163 |
End posion on genome | 33236 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
agagacacaa |
tRNA gene sequence |
GGGATCATAGCTCAGCTGGGAGAGCATCTGCCTTACAAGCAGAGGGTCATAGGTTCGAGT |
Downstream region at tRNA end position |
tccatgaact |
Secondary structure (Cloverleaf model) | >WENV183345193 Val TAC a ACta tccatgaact G - C G - C G - C A - T T + G C - G A - T T G T T A T C C A C G A A | | | | | G T C T C G A T A G G C G | | | | T T G G A G C G A A GGGTC T - A C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |