Sequence ID | >WENV183363474 |
Genome ID | OLXL01004185 |
Search identical group | |
Phylum/Class | [OLXL] human gut metagenome; feces |
Species | |
Start position on genome | 125 |
End posion on genome | 49 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
aagcgaatat |
tRNA gene sequence |
GGAGGATTAGCTCAGCTGGTTAGAGCACCTGCATCACACGCAGGGGGTCTGGGGTTCGAG |
Downstream region at tRNA end position |
tacagttcgt |
Secondary structure (Cloverleaf model) | >WENV183363474 Val CAC t ACCA tacagttcgt G - C G - C A - T G - C G + T A - T T - A T G T A T C C C A C G A A | + | | | G T C T C G T G G G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G T - A G - C C - G A C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |