Sequence ID | >WENV183381045 |
Genome ID | OLYJ01000086 |
Search identical group | |
Phylum/Class | [OLYJ] human gut metagenome; feces |
Species | |
Start position on genome | 108 |
End posion on genome | 22 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aaaacaactt |
tRNA gene sequence |
GGAGAGATATCGAAGCGGTCATAACGAGGCGGTCTTGAAAACCGTTTGTCCGAAAGGGCG |
Downstream region at tRNA end position |
gtgagaacga |
Secondary structure (Cloverleaf model) | >WENV183381045 Ser TGA t GCtg gtgagaacga G - C G - C A - T G - C A - T G - C A C T A T C A C C C A G C G A A | | | | | G G A G C T G T G G G C T | | | T T C A C G A A T A G TTGTCCGAAAGGGCGC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |