Sequence ID | >WENV183382767 |
Genome ID | OLYL01013945 |
Search identical group | |
Phylum/Class | [OLYL] human gut metagenome; feces |
Species | |
Start position on genome | 1452 |
End posion on genome | 1378 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
aggatatcaa |
tRNA gene sequence |
GGGCCTGTAGCTCAGCTAGGTAGAGCATCTGACTTTTAATCAGGTGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
agattcttca |
Secondary structure (Cloverleaf model) | >WENV183382767 Lys TTT a GCtg agattcttca G - C G - C G - C C - G C - G T - A G - C T A T C T C C C A C G A A | + | | | G T C T C G G G G G G C A | | | | T T G G A G C G T A A TGGTC T + G C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |