Sequence ID | >WENV183386137 |
Genome ID | OLYT01019148 |
Search identical group | |
Phylum/Class | [OLYT] human gut metagenome; feces |
Species | |
Start position on genome | 579 |
End posion on genome | 652 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tgacccgtgc |
tRNA gene sequence |
GCGCCCGTAGCTCAGGTGGATAGAGCAACTGCCTTCTAAGCAGTGGGCCAGGGGTTCAAG |
Downstream region at tRNA end position |
tatggtgcct |
Secondary structure (Cloverleaf model) | >WENV183386137 Arg TCT c Attc tatggtgcct G - C C - G G - C C - G C - G C - G G - C T G T T T C C C A G G A A | + | | | A T C T C G A G G G G C G | | | | T T G G A G C A T A A GGGCC A - T C - G T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |