Sequence ID | >WENV183387692 |
Genome ID | OLYY01001258 |
Search identical group | |
Phylum/Class | [OLYY] human gut metagenome; feces |
Species | |
Start position on genome | 5361 |
End posion on genome | 5434 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
cgttcgttgc |
tRNA gene sequence |
GCGGGTATAGCTTAATGGTAAAGCTCCAGCCTTCCAAGCTGATTATACGGGTTCGATTCC |
Downstream region at tRNA end position |
tttttttatt |
Secondary structure (Cloverleaf model) | >WENV183387692 Gly TCC c TCCA tttttttatt G - C C - G G - C G - C G - C T - A A - T T T T T G C C C A A A A | | | | | G T T T C G A C G G G C G | | | | T T G A A G C T A T TTAT C A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |