Sequence ID | >WENV183391682 |
Genome ID | OLZD01013114 |
Search identical group | |
Phylum/Class | [OLZD] human gut metagenome; feces |
Species | |
Start position on genome | 671 |
End posion on genome | 587 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cgtattgatt |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCGTTCGTTTCAGGTGCGAGTGGTTTTGCGATCGTG |
Downstream region at tRNA end position |
cccaaaatag |
Secondary structure (Cloverleaf model) | >WENV183391682 Leu CAG t ACtt cccaaaatag G - C C - G C - G C - G A - T G - C G + T T G T T G T C C A T A A G + | | | | G T G G C G G C A G G C G | | | T T G A C G C T A G G TGGTTTTGCGATCGT T + G T - A C - G G - C T + G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |