Sequence ID | >WENV183394946 |
Genome ID | OLZH01000095 |
Search identical group | |
Phylum/Class | [OLZH] human gut metagenome; feces |
Species | |
Start position on genome | 8821 |
End posion on genome | 8895 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
attgtattta |
tRNA gene sequence |
CGGGGTGTAGCGCAGCCCGGTAGCGCTCCTGGTTTGGGACCAGGTGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
taaggctaag |
Secondary structure (Cloverleaf model) | >WENV183394946 Pro TGG a ACaa taaggctaag C - G G - C G - C G - C G - C T + G G - C T A T T G T C C A C G A A + | | | | G C C G C G G C A G G C C | | | | T T G G C G C G T A T TGGTC C - G C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |