Sequence ID | >WENV183400737 |
Genome ID | OLZS01000076 |
Search identical group | |
Phylum/Class | [OLZS] human gut metagenome; feces |
Species | |
Start position on genome | 3714 |
End posion on genome | 3797 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tccggtcaat |
tRNA gene sequence |
GCCCTCGTGGCGGAATGGTAGACGCTGCAGACTTAAAATCTGTTGTCCGCAAGGACGTAC |
Downstream region at tRNA end position |
cgctgaataa |
Secondary structure (Cloverleaf model) | >WENV183400737 Leu TAA t ACtt cgctgaataa G + T C - G C - G C - G T + G C - G G - C T G T T G G C C A T A A G | | | | | G G G G C G A C C G G C G | | | T T T A C G C A G T TGTCCGCAAGGACGT G + T C - G A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |