Sequence ID | >WENV183404656 |
Genome ID | OLZW01078598 |
Search identical group | |
Phylum/Class | [OLZW] human gut metagenome; feces |
Species | |
Start position on genome | 382 |
End posion on genome | 311 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tgcttgataa |
tRNA gene sequence |
TCCTCGATAGCTCAGCGGTAGAGCATCCGGCTGTTAACCGGAGGGTCGTAGGTTCGAATC |
Downstream region at tRNA end position |
tactataaat |
Secondary structure (Cloverleaf model) | >WENV183404656 Asn GTT a Gttc tactataaat T - A C - G C - G T + G C - G G - C A - T T A T C A T C C A G A A | | | | | G C C T C G G T A G G C G | | | | T T G G A G C T A A GGGTC T - A C - G C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |