Sequence ID | >WENV183419131 |
Genome ID | OMAZ01000002 |
Search identical group | |
Phylum/Class | [OMAZ] human gut metagenome; feces |
Species | |
Start position on genome | 118903 |
End posion on genome | 118829 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
aagacaacat |
tRNA gene sequence |
GCGCCAGTAGCCCAGCGGATTAGAGCAGCTGACTACGGATCAGCAGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
taagcctcga |
Secondary structure (Cloverleaf model) | >WENV183419131 Arg ACG t ACag taagcctcga G - C C - G G - C C - G C - G A - T G - C T A T T G T C C A C G A A + | | | | G G C C C G G C A G G C G | | | T T A G A G C T T A A AGGTC G - C C - G T - A G - C A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |