Sequence ID | >WENV183453583 |
Genome ID | OMDE01000045 |
Search identical group | |
Phylum/Class | [OMDE] human gut metagenome; feces |
Species | |
Start position on genome | 26539 |
End posion on genome | 26458 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gatggtgatt |
tRNA gene sequence |
GCGCGAGTGGCGGAATTGGTAGACGCGCAGGATTTAGGTTCCTGTGTCTTTGACGTGTGG |
Downstream region at tRNA end position |
gtccacgtta |
Secondary structure (Cloverleaf model) | >WENV183453583 Leu TAG t ACat gtccacgtta G - C C - G G - C C - G G - C A - T G - C T G T T A C C C A T A A G + | | | | A T G G C G G T G G G C G | | | T T G A C G C T A G G TGTCTTTGACGT C - G A - T G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |