Sequence ID | >WENV183456457 |
Genome ID | OMDK01001923 |
Search identical group | |
Phylum/Class | [OMDK] human gut metagenome; feces |
Species | |
Start position on genome | 5261 |
End posion on genome | 5177 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ggtggtattt |
tRNA gene sequence |
GCCCAGATGGCGGAATCGGTAGACGCGCTGGTCTCAAACACCAGTGGAGCAATCCATCCC |
Downstream region at tRNA end position |
agatggagag |
Secondary structure (Cloverleaf model) | >WENV183456457 Leu CAA t ACCA agatggagag G + T C - G C - G C - G A - T G - C A - T C T T G G G C C A T A A G | | | | | G C G G C G C C C G G C G | | | T T G A C G C T A G G TGGAGCAATCCAT C - G T - A G - C G - C T - A C C T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |