Sequence ID | >WENV183463019 |
Genome ID | OMDX01006825 |
Search identical group | |
Phylum/Class | [OMDX] human gut metagenome; feces |
Species | |
Start position on genome | 162 |
End posion on genome | 86 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tttgataaat |
tRNA gene sequence |
GGCGGCATAGCTCAGTTGGCTAGAGCATGCGGTTCATACCCGCAGTGTCCCCGGTTCGAA |
Downstream region at tRNA end position |
aaaaaggcgc |
Secondary structure (Cloverleaf model) | >WENV183463019 Met CAT t ACCA aaaaaggcgc G + T G - C C - G G - C G - C C - G A - T T A T G G A C C A T G A A | | | | G T C T C G C C C G G C G | | | | T T G G A G C C T A A GTGTC T - A G - C C - G G - C G - C T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |