Sequence ID | >WENV183491007 |
Genome ID | OMGG01000019 |
Search identical group | |
Phylum/Class | [OMGG] human gut metagenome; human gut |
Species | |
Start position on genome | 157327 |
End posion on genome | 157252 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
agtgcctcat |
tRNA gene sequence |
TCCCCGGTGGCTCAATCGGCAGAGCGGGTGACTGTTAATCACTAGGTTGGCGGTTCAAGT |
Downstream region at tRNA end position |
gaaagtacaa |
Secondary structure (Cloverleaf model) | >WENV183491007 Asn GTT t GCCA gaaagtacaa T - A C - G C - G C - G C - G G - C G - C T G T C T G C C A T A A G | + | | | A C C T C G G G C G G C G | | | | T T G G A G C C A G AGGTT G + T G - C T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |