Sequence ID | >WENV183492929 |
Genome ID | OMGI01002154 |
Search identical group | |
Phylum/Class | [OMGI] human gut metagenome; human gut |
Species | |
Start position on genome | 5505 |
End posion on genome | 5431 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
atgaggctat |
tRNA gene sequence |
GGCCCATTCGTCTATCGGTTAGGACGCAAGATTTTCATTCTTGAAAGAGGAGTTCGATTC |
Downstream region at tRNA end position |
tcgaaatgta |
Secondary structure (Cloverleaf model) | >WENV183492929 Glu TTC t ACCA tcgaaatgta G + T G - C C - G C - G C - G A - T T - A T T T T C C T C A C T A C | | | | | G G T C T G A G G A G C G + | | | T T T G G A C T A G AAAG C - G A - T A - T G - C A - T T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |