Sequence ID | >WENV183498538 |
Genome ID | OMGP01000046 |
Search identical group | |
Phylum/Class | [OMGP] human gut metagenome; human gut |
Species | |
Start position on genome | 424 |
End posion on genome | 497 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
aaaaacagtt |
tRNA gene sequence |
GCCGAAATGGCTCAGTTGGTAGAGCAATTCATTCGTAATGAATAGGTCCCGGGTTCGAGT |
Downstream region at tRNA end position |
gaagcggtag |
Secondary structure (Cloverleaf model) | >WENV183498538 Thr CGT t TCaa gaagcggtag G - C C - G C - G G - C A - T A - T A - T T G T G G C C C A T G A G | | | | | G T C T C G C C G G G C G | | | | T T G G A G C T A A AGGTC A - T T - A T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |