Sequence ID | >WENV183501317 |
Genome ID | OMGS01000046 |
Search identical group | |
Phylum/Class | [OMGS] human gut metagenome; human gut |
Species | |
Start position on genome | 31062 |
End posion on genome | 30987 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
ttcacgccac |
tRNA gene sequence |
GGGTCATTAGCTCAATTGGTAGAGCAGCTGACTCTTAATCAGTTGGTTCGGGGTTCGAGT |
Downstream region at tRNA end position |
agaaaatacg |
Secondary structure (Cloverleaf model) | >WENV183501317 Lys CTT c ACCA agaaaatacg G - C G - C G - C T + G C - G A - T T - A T G T G T C C C A T A A A | + | | | G T C T C G C G G G G C G | | | | T T G G A G C T A A TGGTT G + T C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |