Sequence ID | >WENV183501528 |
Genome ID | OMGS01000498 |
Search identical group | |
Phylum/Class | [OMGS] human gut metagenome; human gut |
Species | |
Start position on genome | 3779 |
End posion on genome | 3688 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gcccatccac |
tRNA gene sequence |
GGAGAGGTGTCCGAGCTGGTCTAAGGAGCACGATTGGAAATCGTGTGTACGTTAACAGCG |
Downstream region at tRNA end position |
gatttcaagg |
Secondary structure (Cloverleaf model) | >WENV183501528 Ser GGA c GCCA gatttcaagg G - C G - C A - T G - C A - T G - C G - C T A T C A C T C A T C G A G | | | | | G G G C C T G T G A G C G | | | T T T A G G A C T A G TGTACGTTAACAGCGTACC C - G A - T C - G G - C A - T T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |