Sequence ID | >WENV183510335 |
Genome ID | OMHN01006655 |
Search identical group | |
Phylum/Class | [OMHN] human oral metagenome; human oral |
Species | |
Start position on genome | 284 |
End posion on genome | 357 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
gcataatccc |
tRNA gene sequence |
GCCCCGTTCGTCTAGCGGCCCAGGACACCGCCCTCTCACGGCGGCAGCACCGGTTCAAAT |
Downstream region at tRNA end position |
gccgcccggc |
Secondary structure (Cloverleaf model) | >WENV183510335 Glu CTC c CCtc gccgcccggc G + T C - G C - G C - G C - G G - C T - A T A T T G G C C A C G A C | | | | | A G T C T G A C C G G C G + | | | T T C G G A C C C A A CAGC C - G C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |