Sequence ID | >WENV183511899 |
Genome ID | OMJG01010706 |
Search identical group | |
Phylum/Class | [OMJG] food metagenome; Cotija cheese |
Species | |
Start position on genome | 553 |
End posion on genome | 479 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gcgcaggcgt |
tRNA gene sequence |
GCCGCCTTAGCTCAGTCGGCAGAGCGATTCACTCGTAATGAATAGGTCGGGGGTTCGATT |
Downstream region at tRNA end position |
caggtaaggc |
Secondary structure (Cloverleaf model) | >WENV183511899 Thr CGT t TCCg caggtaaggc G - C C - G C - G G - C C - G C - G T - A T T T C C C C C A T G A A | | | | | G C C T C G G G G G G C G | | | | T T G G A G C C A G AGGTC A - T T - A T - A C - G A - T C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |