Sequence ID | >WENV183518199 |
Genome ID | OMNQ01000318 |
Search identical group | |
Phylum/Class | [OMNQ] human gut metagenome; feces |
Species | |
Start position on genome | 12544 |
End posion on genome | 12619 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
aaagatatat |
tRNA gene sequence |
CGCGGGATGGAGCAGTTGGCAGCTCGTCGGGCTCATAACCCGAAGGTCGGAGGTTCGAGT |
Downstream region at tRNA end position |
aagcggacaa |
Secondary structure (Cloverleaf model) | >WENV183518199 fMet CAT t ACCA aagcggacaa C T G - C C - G G - C G - C G - C A - T T G T C C T C C A T G A G | | | | | G T C G A G G G A G G C G | | | | T T G G C T C C A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |