Sequence ID | >WENV183522503 |
Genome ID | ONZR01000115 |
Search identical group | |
Phylum/Class | [ONZR] human gut metagenome; human gut |
Species | |
Start position on genome | 31466 |
End posion on genome | 31551 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gcgcacataa |
tRNA gene sequence |
GGACAGGTGTCTGAGCGGCCTAAAGAGACGGTCTTGAAAACCGTTGTGGTGCAAGCCACC |
Downstream region at tRNA end position |
atcggggttc |
Secondary structure (Cloverleaf model) | >WENV183522503 Ser TGA a GCat atcggggttc G - C G - C A - T C - G A - T G - C G - C T A T C G C T C A C G A G | | | | | G G G T C T G C G A G C G | | | T T C A A G A C T A G TGTGGTGCAAGCCACC A - T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |