Sequence ID | >WENV183529644 |
Genome ID | ONZZ01002384 |
Search identical group | |
Phylum/Class | [ONZZ] human gut metagenome; human gut |
Species | |
Start position on genome | 9881 |
End posion on genome | 9965 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gataaaggcc |
tRNA gene sequence |
GCGGTCGTGGCGAAATTGGTAGACGCACTATCTTGAGGGGGTAGCGGAGCAATCCATATG |
Downstream region at tRNA end position |
cggactgggg |
Secondary structure (Cloverleaf model) | >WENV183529644 Leu GAG c ACCA cggactgggg G - C C - G G - C G - C T - A C - G G - C T A T T A C T C A T A A G | | | | | A T A G C G A T G A G C G | | | T T G A C G C T A G A CGGAGCAATCCAT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |