Sequence ID | >WENV183540028 |
Genome ID | OOAJ01001621 |
Search identical group | |
Phylum/Class | [OOAJ] human gut metagenome; human gut |
Species | |
Start position on genome | 5020 |
End posion on genome | 4946 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ccatgaatgc |
tRNA gene sequence |
TGGGATGTAGCCAAGTGGTAAGGCAACGGGTTTTGGCTCCGTCATCCGAAGGTTCGAGCC |
Downstream region at tRNA end position |
cacccaaacc |
Secondary structure (Cloverleaf model) | >WENV183540028 Gln TTG c GCCA cacccaaacc T - A G - C G - C G - C A - T T - A G - C C G T C T T C C A G A A | | | | | G T A C C G G A A G G C G | | | T T G A G G C T A A CATCC A - T C - G G - C G - C G + T T C T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |