Sequence ID | >WENV183543033 |
Genome ID | OOAN01000672 |
Search identical group | |
Phylum/Class | [OOAN] human gut metagenome; human gut |
Species | |
Start position on genome | 13840 |
End posion on genome | 13915 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tggagcactt |
tRNA gene sequence |
GCAGGGTTAGCTCATCCGGTAGAGCGACTGCTTCCCAAGCAGTAGGCGGCGGGTTCGAGT |
Downstream region at tRNA end position |
gaatatagcg |
Secondary structure (Cloverleaf model) | >WENV183543033 Gly CCC t TCCA gaatatagcg G - C C - G A - T G - C G - C G + T T - A T G T T G C C C A C T A A + | | | | G C C T C G G C G G G C G | | | | T T G G A G C T A G AGGCG A - T C - G T - A G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |