Sequence ID | >WENV183552279 |
Genome ID | OOBJ01002180 |
Search identical group | |
Phylum/Class | [OOBJ] human gut metagenome; human gut |
Species | |
Start position on genome | 125 |
End posion on genome | 200 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tgattttcat |
tRNA gene sequence |
AGGGGTATAGCTCAACTGGTAGAGTAGTGGTCTCCAAAACCATTGGTTGAGGGTTCGATT |
Downstream region at tRNA end position |
catggaaagg |
Secondary structure (Cloverleaf model) | >WENV183552279 Trp CCA t GCCA catggaaagg A - T G - C G - C G - C G - C T + G A - T T T T C T T C C A C A A A | | + | | G T C T C G G A G G G C G | | | + T T G G A G T T A A TGGTT G + T T - A G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |