Sequence ID | >WENV183554675 |
Genome ID | OOBN01000031 |
Search identical group | |
Phylum/Class | [OOBN] human gut metagenome; human gut |
Species | |
Start position on genome | 63011 |
End posion on genome | 62936 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
accattttat |
tRNA gene sequence |
GCGGCCGTAGCTCATCTGGTAGAGCGCCACCTTGCCAAGGTGGAGGTAGCGAGTTCGAGC |
Downstream region at tRNA end position |
cttttgacca |
Secondary structure (Cloverleaf model) | >WENV183554675 Gly GCC t TCCA cttttgacca G - C C - G G - C G - C C - G C - G G - C C G T T G C T C A C T A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A G AGGTA C - G C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |