Sequence ID | >WENV183575117 |
Genome ID | OOCI01000407 |
Search identical group | |
Phylum/Class | [OOCI] human gut metagenome; human gut |
Species | |
Start position on genome | 24635 |
End posion on genome | 24549 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
acatttccgc |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGTAGACACGCTAGGTTCAGGGTCTAGTTCTGGCAACGGAGTG |
Downstream region at tRNA end position |
acagaaagtc |
Secondary structure (Cloverleaf model) | >WENV183575117 Leu CAG c ACCA acagaaagtc G - C C - G C - G G - C A - T A - T G - C T C T C C C T C A T A A G | | | | | G T G G T G G G G A G C G | | | T T G A C A C T A G G TTCTGGCAACGGAGT C - G T - A A - T G - C G + T T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |