Sequence ID | >WENV183576762 |
Genome ID | OOCJ01001069 |
Search identical group | |
Phylum/Class | [OOCJ] human gut metagenome; human gut |
Species | |
Start position on genome | 7545 |
End posion on genome | 7621 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ccaccactac |
tRNA gene sequence |
GGCCCGGTAGTTTAGTTGGTTAGAATGCCGCCCTGTCACGGCGGAGGTCAGGGGTTCAAG |
Downstream region at tRNA end position |
tttttatttg |
Secondary structure (Cloverleaf model) | >WENV183576762 Asp GTC c GCCA tttttatttg G - C G + T C - G C - G C - G G - C G + T T G T T C C C C A T G A A | | | | | A T T T T G A G G G G C G + | | + T T G G A A T T T A G AGGTC C - G C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |