Sequence ID | >WENV183578185 |
Genome ID | OOCL01000082 |
Search identical group | |
Phylum/Class | [OOCL] human gut metagenome; human gut |
Species | |
Start position on genome | 43561 |
End posion on genome | 43635 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
gttgcaacgt |
tRNA gene sequence |
GGGGCGTTAGCTCAGTCGGTTAGAGCATCGGACTCATAATCCGCCGGTCCACGGTTCAAG |
Downstream region at tRNA end position |
tttcacaaag |
Secondary structure (Cloverleaf model) | >WENV183578185 Ile2 CAT t ACtc tttcacaaag G - C G - C G - C G - C C - G G - C T - A C G T G T G C C A T G A A | | | | | A C C T C G C A C G G C G | | | | T T G G A G C T T A A CGGTC T C C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |