Sequence ID | >WENV183589125 |
Genome ID | OOCW01000063 |
Search identical group | |
Phylum/Class | [OOCW] human gut metagenome; human gut |
Species | |
Start position on genome | 12574 |
End posion on genome | 12649 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
acaaagaaaT |
tRNA gene sequence |
GTGCGTTTAGCTCAGCTGGATAGAGCGTTTGGCTACGGACCAAAAGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
ggtaaccgtc |
Secondary structure (Cloverleaf model) | >WENV183589125 Arg ACG T GGac ggtaaccgtc G - C T - A G - C C - G G - C T - A T - A T A T T C T C C A C G A A + | + | | G T C T C G G G G G G C G | | | | T T G G A G C A T A G AGGTC T - A T - A T - A G - C G - C C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |