Sequence ID | >WENV183595654 |
Genome ID | OODD01000198 |
Search identical group | |
Phylum/Class | [OODD] human gut metagenome; human gut |
Species | |
Start position on genome | 47549 |
End posion on genome | 47624 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ttttttattt |
tRNA gene sequence |
GGGCGGTTAGCTCAGCTGGGAGAGCGCTTGCCTTACAAGCAAGATGTCAGCAGTTCGATC |
Downstream region at tRNA end position |
taatgaaata |
Secondary structure (Cloverleaf model) | >WENV183595654 Val TAC t ACCA taatgaaata G - C G - C G - C C - G G - C G - C T - A C T T T T G T C A C G A A | + | | | G T C T C G A G C A G C G | | | | T T G G A G C G A G ATGTC C - G T - A T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |