Sequence ID | >WENV183601134 |
Genome ID | OODJ01000325 |
Search identical group | |
Phylum/Class | [OODJ] human gut metagenome; human gut |
Species | |
Start position on genome | 36338 |
End posion on genome | 36262 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aggacagcac |
tRNA gene sequence |
GCGCTCGTAGCTCAGGTGGATAGAGCAGGAGCCTTCTAAGCTCTTGGCCGGGGGTTCGAA |
Downstream region at tRNA end position |
tggaactatc |
Secondary structure (Cloverleaf model) | >WENV183601134 Arg TCT c GCCA tggaactatc G - C C - G G - C C - G T + G C - G G - C T A T C C T C C A G G A A | | + | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A TGGCC G + T G - C A - T G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |