Sequence ID | >WENV183610866 |
Genome ID | OODS01011095 |
Search identical group | |
Phylum/Class | [OODS] human gut metagenome; human gut |
Species | |
Start position on genome | 2486 |
End posion on genome | 2414 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cgtctaatat |
tRNA gene sequence |
GCCGTTGTGGCTCAATTGGCAGAGCAGCTGATTTGTAATCAGCAGGTTACCGGTTCAAGT |
Downstream region at tRNA end position |
aacggacctt |
Secondary structure (Cloverleaf model) | >WENV183610866 Thr TGT t Ttta aacggacctt G - C C - G C - G G - C T - A T - A G - C T G T T G G C C A T A A G | | | | | A T C T C G A C C G G C G | | | | T T G G A G C C A A AGGTT G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |